869 a 3 bit lfsr counter modifications to include the all 0s state are shown in color

Báo cáo khoa học: "Veterinary decision making in relation to metritis - a qualitative approach to understand the background for variation and bias in veterinary medical records"

Báo cáo khoa học: "Veterinary decision making in relation to metritis - a qualitative approach to understand the background for variation and bias in veterinary medical records"

Ngày tải lên : 25/10/2012, 10:45
... Acta Veterinaria Scandinavica 2009, 51 :36 Background Files with information on animal disease have a variety of applications at both the herd and national level, including monitoring the incidence ... purposes) Acta Veterinaria Scandinavica 2009, 51 :36 cal analyses in the future, and they are highly motivated to use, for instance, multi-factorial analysis on the herd level or higher levels in their ... provides insight into potential errors (bias and random error) related to data based on clinical examina- Page of 10 (page number not for citation purposes) Acta Veterinaria Scandinavica 2009, 51 :36 ...
  • 10
  • 587
  • 0
A computational study to investigate the effects of insulation and EGR in a diesel engine

A computational study to investigate the effects of insulation and EGR in a diesel engine

Ngày tải lên : 05/09/2013, 16:11
... of engine: base line, adiabatic and also adding EGR to the initial charge of adiabatic case at two load operating conditions: a full load and a part load (50% load) At all the cases, engine speed ... [29] Arash Nemati, Shahram Khalilarya, Samad Jafarmadar, Hassan Khatamnejhad, Vahid Fathi Numerical parametric investigation of a gasoline fuelled partially-premixed compression-ignition engine International ... NOx As shown in Figure 11e, at 38 0°CA, the NO forms in the swirl chamber throat, pre and main chambers and then transferred into the main chamber at 400°CA for baseline engine While at adiabatic...
  • 20
  • 643
  • 0
Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx

Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx

Ngày tải lên : 07/03/2014, 21:20
... sequence VBARP-L 1.9 VBARP-S 1 .3 AACAATGCTGACTGATAGCGGAGGA (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 ... 5¢-GATAAGGTACCTGCACTGACACGGATG AAAGC -3 and reverse 5¢-CTAGACTCGAGCCTAAT TTATATTTGCTCCTTGTGC -3 b-Actin primers were designed as follows: forward 5¢-CTACAATGAGCTGCG TGT -3 and reverse 5¢-AAGGAAGGCTGGAAGAGT -3 ... of cysteine acid proteases, are central regulators of apoptosis [12, 13] Caspases are routinely used as a measure of apoptosis, in contrast to necrosis Caspase activation occurs at the intersection...
  • 12
  • 561
  • 0
Báo cáo khoa học: Saporin and ricin A chain follow different intracellular routes to enter the cytosol of intoxicated cells pptx

Báo cáo khoa học: Saporin and ricin A chain follow different intracellular routes to enter the cytosol of intoxicated cells pptx

Ngày tải lên : 23/03/2014, 15:21
... clathrin-coated pits [19 ,33 ] and the binding and internalization of another type I RIP, trichosanthin [34 ], and PEA [3, 13] Thus, saporin is able to use the same internalization receptor as PEA ... bafilomycin A1 prior to the addition of toxin dilutions In all cases the appropriate drug was maintained at the same concentration in both the toxin dilutions and the labeling mix RNA extraction and ... holotoxin and the A chain alone [10–12] Thus, the catalytic domains of different bacterial and plant protein toxins, including ricin [8], PEA [2 ,3] cholera toxin and Shiga toxin, can exploit the ERAD...
  • 13
  • 389
  • 0
Khóa luận tốt nghiệp tiếng anh: A study on using Role Play to motivate the 10th form students in speaking lessons at Lao Cai boarding upper secondary school, Lao Cai province –An experiment

Khóa luận tốt nghiệp tiếng anh: A study on using Role Play to motivate the 10th form students in speaking lessons at Lao Cai boarding upper secondary school, Lao Cai province –An experiment

Ngày tải lên : 07/06/2014, 16:13
... the main determining factors in success in foreign language 2.2.4 Factors affecting learner’s motivation in language learning There are many factors that affect students’ motivation such as the ... lack to practice the second language in daily conversation They are also too shy and afraid to take part in the conversation Many factors can cause the problem of the students’ speaking skills namely ... because they find the speaking topics difficult and unfamiliar to them They reveal that sometimes they want to take part in speaking yet they find no way to express their ideas in English 11% 38 .60%...
  • 92
  • 3.8K
  • 13
báo cáo hóa học:" A lifeline to treatment: the role of Indian generic manufacturers in supplying antiretroviral medicines to developing countries" pptx

báo cáo hóa học:" A lifeline to treatment: the role of Indian generic manufacturers in supplying antiretroviral medicines to developing countries" pptx

Ngày tải lên : 20/06/2014, 08:20
... coordinated the study, participated in data cleaning and data analysis, and was the lead author on this paper ED performed data cleaning and data analysis SM contributed to data analysis, writing ... universal access to HIV/AIDS interventions and the 2001 WTO Doha Declaration on TRIPS and Public Health [25] Rather than agreeing to inappropriate intellectual property obligations, India and its ... barriers and were, therefore, unable to quantitatively examine these issues in our study While we systematically cleaned and validated all transactional data, we cannot be confident that we have...
  • 9
  • 283
  • 0
báo cáo hóa học: " A tool to measure the attributes of receiving IV therapy in a home versus hospital setting: the Multiple Sclerosis Relapse Management Scale (MSRMS)" pot

báo cáo hóa học: " A tool to measure the attributes of receiving IV therapy in a home versus hospital setting: the Multiple Sclerosis Relapse Management Scale (MSRMS)" pot

Ngày tải lên : 20/06/2014, 15:20
... the remaining 132 people are shown in Table and the psychometrics of the MSRMS in Tables 3, 4, and Data quality (Table 3) Item level missing data for all scales was low (max = 3. 8%) Total scores ... data and writing of the manuscript All authors read and approved the final manuscript Competing interests The authors declare that they have no competing interests Received: 13 January 2011 Accepted: ... single domain (interpersonal care) because they formed a more clinical and statistical cohesive set together rather than existing as separate scales For the same reasons, three domains (physical comfort,...
  • 8
  • 492
  • 0
báo cáo khoa học: " Evaluating the effectiveness of a tailored multifaceted performance feedback intervention to improve the quality of care: protocol for a cluster randomized trial in intensive care" pps

báo cáo khoa học: " Evaluating the effectiveness of a tailored multifaceted performance feedback intervention to improve the quality of care: protocol for a cluster randomized trial in intensive care" pps

Ngày tải lên : 10/08/2014, 11:20
... trial to evaluate the effect of the InFoQI program on the quality of ICU care and a qualitative process evaluation to gain insight into the barriers and success factors that affected the program’s ... quality indicator data set At the NICE coordination center, dedicated data managers, software engineers, and a coordinator are responsible for routine processing, storing, checking, and reporting ... available and includes data quality audits, support with data collection, and additional data analyses on request Furthermore, they are invited to a yearly discussion meeting where they can share...
  • 10
  • 421
  • 0
A work force model to support the adoption of best practice care in chronic diseases – a missing piece in clinical guideline implementation pot

A work force model to support the adoption of best practice care in chronic diseases – a missing piece in clinical guideline implementation pot

Ngày tải lên : 11/08/2014, 05:21
... clinical practice guideline by clinicians This requires that guidelines are written in a way that is clear to clinicians and translatable into actions and an effective dissemination strategy A ... barriers to optimal health care J Contin Educ Health Prof 2007, 27:94-102 Gravel K, Legare F, Graham I: Barriers and facilitator to implementing shared decision-making in clinical practice: a systematic ... patient behaviour These include financial incentives (payment arrangement for clinicians and user charges on consumers), quality audit/quality assurance and accountability arrangements, and a health...
  • 9
  • 486
  • 0
Báo cáo y học: " Act In case of Depression: The evaluation of a care program to improve the detection and treatment of depression in nursing homes. Study Protocol" pptx

Báo cáo y học: " Act In case of Depression: The evaluation of a care program to improve the detection and treatment of depression in nursing homes. Study Protocol" pptx

Ngày tải lên : 11/08/2014, 15:22
... additionally in the care program to gain one percentage point decrease in frequency of depression?’ and ‘How much money has to be invested additionally in the care program to gain one Quality-Adjusted ... strategy should be incorporated in regular care The psychologist supervises the recreational therapist and nursing staff in at least regular staff meetings Additionally, if the depression in ... evaluation This study investigates the efficiency of the care program AID compared to usual care as provided in NH units If the program AID turns out to be successful, a decrease in the prevalence...
  • 7
  • 484
  • 0
báo cáo khoa học: " A work force model to support the adoption of best practice care in chronic diseases – a missing piece in clinical guideline implementation" ppt

báo cáo khoa học: " A work force model to support the adoption of best practice care in chronic diseases – a missing piece in clinical guideline implementation" ppt

Ngày tải lên : 11/08/2014, 16:21
... clinical practice guideline by clinicians This requires that guidelines are written in a way that is clear to clinicians and translatable into actions and an effective dissemination strategy A ... barriers to optimal health care J Contin Educ Health Prof 2007, 27:94-102 Gravel K, Legare F, Graham I: Barriers and facilitator to implementing shared decision-making in clinical practice: a systematic ... patient behaviour These include financial incentives (payment arrangement for clinicians and user charges on consumers), quality audit/quality assurance and accountability arrangements, and a health...
  • 9
  • 368
  • 0
Báo cáo khoa học: " A mixed methods inquiry: How dairy farmers perceive the value(s) of their involvement in an intensive dairy herd health management program" doc

Báo cáo khoa học: " A mixed methods inquiry: How dairy farmers perceive the value(s) of their involvement in an intensive dairy herd health management program" doc

Ngày tải lên : 12/08/2014, 18:22
... hypothetical respondent with a 100% loading on that factor would rank all the statements according to the guide for ranking Page of 12 The vet helps to educate my staff 41 Acta Veterinaria Scandinavica ... thinks, that farmers are the kind of people that beat up animals' Farmers sharing the second viewpoint believed that HHM was an important tool to increase AWHH These farmers explained that an increase ... to increase the overall farm production, i.e 'I tell you, animal welfare and economy is really closely connected The reason that I care about animal welfare is because it is a financially reasonable...
  • 12
  • 235
  • 0
A study on using short stories to improve the effeciency of teaching speaking and listening skills to students at Haiphong Foreign Language Centre = Nghiên cứu

A study on using short stories to improve the effeciency of teaching speaking and listening skills to students at Haiphong Foreign Language Centre = Nghiên cứu

Ngày tải lên : 28/03/2015, 08:54
... so that teachers can discuss problems and exchange ideas They are all eager to apply initiatives in teaching, and ready to welcome new ideas At Haiphong Foreign Language Centre there are classes ... those who are keen on using literature in language teaching in general, and in teaching and learning English in general, in listening and speaking skills in particular 37 38 REFERENCES Bailey, ... in the story rather in the language  Role-playing: The students play the roles of some characters in the story, action out some scene in the story as assigned by the teacher The dialogues can...
  • 48
  • 1K
  • 2
Unit 8 Out and About A 1 -A 3

Unit 8 Out and About A 1 -A 3

Ngày tải lên : 23/10/2013, 08:11
... are walking to school start What are they doing? 10 They are traveling to school by bus start 10 What are they doing? They are waiting for a train Answer then write a. What are you doing? c.What ... walking to school We are travelling to school by bus They are travelling to school by bus We are waiting for a train They are waiting for a train Ask and answer What is he doing? He is ing… What is ... doing? He is watching Tv Ask and answer What is he doing? He is reading book Ask and answer What is she doing? She is driving her car Ask and answer What are they doing? They are driving a car...
  • 46
  • 477
  • 0
E7 Unit 8 A 3-4

E7 Unit 8 A 3-4

Ngày tải lên : 05/11/2013, 11:11
... ENGLISH Market Station University Post Office Hotel Hospital Restaurant Bank Shoe store Hotel Post office Police station Book store School Example Nga: Where is the bank? Nam: The bank is between the ... bank? Nam: The bank is between the hotle and the restaurant It’s opposite the hospital Ha noi 890 km Vinh 100 km Hue Da Nang 1 ,34 5 km 1,1 23 km Ho Chi Minh city ...
  • 7
  • 415
  • 0
Tài liệu w w w . a d c . c o m • + 1 - 9 5 2 - 9 3 8 - 8 0 8 0 • 1 - 8 0 0 - 3 6 6 - 3 8 9 1 127 Copper Connectivity Solutions – Specialty Products Copper Connectivity Solutions – Specialty Products pptx

Tài liệu w w w . a d c . c o m • + 1 - 9 5 2 - 9 3 8 - 8 0 8 0 • 1 - 8 0 0 - 3 6 6 - 3 8 9 1 127 Copper Connectivity Solutions – Specialty Products Copper Connectivity Solutions – Specialty Products pptx

Ngày tải lên : 24/01/2014, 11:20
... unit from bottom to top Flip and snap into place Features •  Appropriate for both data and voice application •  High-density and quick installation are the hallmarks of the 25-pair Feed-Thru ... Specialty Products TrueNet® Structured Cabling The Ethernet test access panel allows noninvasive testing and monitoring of Ethernet signals up to and including Gigabit Ethernet As carrier and ... deployment The 25-pair connectors are oriented for top feed cable assemblies Available in either 100-, 200- or 30 0-pair, these blocks are ideal for use with ADC cable for a complete broadband/DSL transmission...
  • 16
  • 368
  • 0
Báo cáo khoa học: Phenylalanine-independent biosynthesis of 1,3,5,8-tetrahydroxyxanthone A retrobiosynthetic NMR study with root cultures of Swertia chirata docx

Báo cáo khoa học: Phenylalanine-independent biosynthesis of 1,3,5,8-tetrahydroxyxanthone A retrobiosynthetic NMR study with root cultures of Swertia chirata docx

Ngày tải lên : 08/03/2014, 02:21
... metabolites that are derived from an early shikimate derivative as opposed to a pathway via phenylalanine and cinnamate A hypothetical mechanism for the conversion of shikimic acid (3) into 3- hydroxybenzoate ... fractions of each respective satellite pair in the total 13C-NMR signal integral of a given carbon atom were then calculated (% 13C13C in Table 1) These values were normalized to the 13 C abundances ... spectra of 13C-enriched samples Coupling partners are given in parentheses b Absolute 13C abundance c Calculated as the fraction of 13C coupled satellite pairs in the total signal intensity for a...
  • 9
  • 464
  • 0
PART THREE Practical Examples203trailing my stop, I’ll be frustrated for turning a 3/8- to pdf

PART THREE Practical Examples203trailing my stop, I’ll be frustrated for turning a 3/8- to pdf

Ngày tải lên : 22/06/2014, 18:20
... shares The stock had another shallow pullback after my exit Selling was again being absorbed I tested the $30 5/8 level again and broke it Notice the ascending line in the volume chart indicating ... indicating a large spike I wanted to look to exit the remaining shares on this larger volume I chose the area of $30 3/4 to $31 as a reasonable exit area On the break of $30 3/4, the stock hit a high ... an exit strategy that would yield a near 2:1 reward/risk ratio Selling was faster into the $24 area, and I looked to scale out into that faster selling In this case, the faster selling took the...
  • 27
  • 228
  • 0
giáo án đại 8 - kì 1 - 3 cột

giáo án đại 8 - kì 1 - 3 cột

Ngày tải lên : 20/10/2014, 01:00
... xét, s a sai 21 Bài 31 trang 16 Sgk a) VP: (a + b )3 – 3ab (a + b) = a3 + 3a2 b+ 3ab2+ b3– 3a2 b – 3ab2 = a3 + b3 Vậy :a3 + b3 = (a+ b )33 ab (a+ b) b) (a – b )3 + 3ab (a- b) = a3 – 3a2 b +3ab2 – b2 = a3 - b3 Bài ... Từ [a+ (-b) ]3 rút (a- b )3 (A- B )3= A3 - 3A2 B+3AB2 -B3 ?4 (A- B )3= A3 - 3A2 B+3AB2 -B3 - Hai HS phát biểu lời Ap dụng: - Làm tập áp dụng 3 - Gọi HS viết kết a, b a (x -1 /3) 3= = x3-x2+1/3x - a) (x -1 /3) = ... + b2) - b (a2 + ab + b2) = a3 + a2 b + ab2 - a2 b -ab2- b3 = a3 - b3 HS trả lời: a3 - b3 = (a - b) (a2 + ab + b2) - HS trả lời A3 - B3= (A - B) (A2 + AB + B2) A3 - B3= (A - B) (A2 + AB + B2) HS đọc...
  • 102
  • 422
  • 0
giáo án hình 8- kì 1- 3 cột

giáo án hình 8- kì 1- 3 cột

Ngày tải lên : 20/10/2014, 01:00
... thang minh hỡnh thang cõn cõn A D 50 E B C Gii a) Ta cú: Tam giỏc ABC cõn t i A 180 A => B = C = AD =AE => tam giỏc ADE cõn ti A 1800 A 180 A => ADE = AED = B = ADE = ; ADE l hai ... xng trc i xng tõm Hai im i xng d A A A A O A v A i xng qua A v A i xng qua O d O l trung im ca d l ng trung trc on thng AA ca on thng AA Hai hỡnh i xng A d B A A O B B B A Hỡnh cú trc i ... dng: 30 0 + Dng tam giỏc u ABC + Dng phõn giỏc ca mt A gúc chng hn gúc A ta c gúc BAE =30 0 Chng minh: - Theo cỏch dng ABC l B C tam giỏc u nờn CAB = 60 D - Theo cỏch dng tia phõn giỏc AE ta cú...
  • 104
  • 1.8K
  • 0